Molecular Post Gazette

Global Research Source and Services

Human UXS1(UDP Glucuronate Decarboxylase 1) ELISA Kit

Human UXS1(UDP Glucuronate Decarboxylase 1) ELISA Kit

Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit

SEG906Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids.

Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit

SEG906Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids.

Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit

SEG906Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids.

Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as UDP Glucuronate Decarboxylase 1 elisa. Alternative names of the recognized antigen: UGD
  • SDR6E1
  • Short Chain Dehydrogenase/reductase Family 6E, Member 12
  • UDP-glucuronic acid decarboxylase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human UDP Glucuronate Decarboxylase 1 (UXS1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human UXS1 (UDP Glucuronate Decarboxylase 1)

ELK5293 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to UDP Glucuronate Decarboxylase 1 (UXS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of UDP Glucuronate Decarboxylase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human UDP- glucuronic acid decarboxylase 1, UXS1 ELISA KIT

ELI-16868h 96 Tests
EUR 824

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody

abx027193-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody

abx027193-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse UDP- glucuronic acid decarboxylase 1, Uxs1 ELISA KIT

ELI-22464m 96 Tests
EUR 865

Rat UDP-glucuronic acid decarboxylase 1 (UXS1) ELISA Kit

abx392098-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse UDP-glucuronic acid decarboxylase 1 (UXS1) ELISA Kit

abx390825-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1)

KTE60076-48T 48T
EUR 332
  • UDP-glucuronate decarboxylase (UGD
  • EC catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans. The topology of the deduced 420-amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1)

KTE60076-5platesof96wells 5 plates of 96 wells
EUR 2115
  • UDP-glucuronate decarboxylase (UGD
  • EC catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans. The topology of the deduced 420-amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1)

KTE60076-96T 96T
EUR 539
  • UDP-glucuronate decarboxylase (UGD
  • EC catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans. The topology of the deduced 420-amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Uxs1 ELISA Kit| Mouse UDP-glucuronic acid decarboxylase 1 ELISA

EF016469 96 Tests
EUR 689

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Uxs1 ELISA Kit| Rat UDP-glucuronic acid decarboxylase 1 ELISA K

EF019458 96 Tests
EUR 689

UDP-Glucuronate 5'-Epimerase (lspL) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Rhizobium meliloti UDP-glucuronate 5'-epimerase (lspL)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rhizobium meliloti UDP-glucuronate 5'-epimerase(lspL) expressed in E.coli

UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Uxs1/ Rat Uxs1 ELISA Kit

ELI-17782r 96 Tests
EUR 886


EF005687 96 Tests
EUR 689

UXS1 ELISA Kit (Human) (OKCD01936)

OKCD01936 96 Wells
EUR 831
Description: Description of target: Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose. Necessary for the biosynthesis of the core tetrasaccharide in glycosaminoglycan biosynthesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL

GAD1 iso1 Glutamate Decarboxylase 1 Isoform-1 Human Recombinant Protein

PROTQ99259-1 Regular: 20ug
EUR 317
Description: GAD1 iso1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 617 amino acids (1-594 a.a) and having a molecular mass of 69.3kDa. GAD1 iso1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

UXS1 Antibody

47406-100ul 100ul
EUR 252

UXS1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UXS1. Recognizes UXS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

UXS1 antibody

70R-7443 50 ug
EUR 467
Description: Rabbit polyclonal UXS1 antibody raised against the middle region of UXS1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit

abx250749-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human UDP-glucuronosyltransferase 1-1

EK3151 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human UDP-glucuronosyltransferase 1-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human UGT1A1/ UDP-glucuronosyltransferase 1-1 ELISA Kit

E2638Hu 1 Kit
EUR 605

Human UGT1A1(UDP-glucuronosyltransferase 1-1) ELISA Kit

EH1469 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P22309
  • Alias: UGT1A1/UDP-glucuronosyltransferase 1-1/UDPGT 1-1/bilirubin UDP-glucuronosyltransferase 1-1/UDP glucuronosyltransferase 1 family, polypeptide A1/UGT1*1/UGT1-01/UGT1.1/UDP-glucuronosyltransferas
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human UDP- glucuronosyltransferase 1- 1, UGT1A1 ELISA KIT

ELI-04284h 96 Tests
EUR 824

5-OMe-UDP trisodium salt

B5568-1 1 mg
EUR 431

Human UXS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UXS1 Recombinant Protein (Human)

RP034192 100 ug Ask for price

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Human UDP glucuronosyltransferase ELISA kit

E01U0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP glucuronosyltransferase ELISA kit

E01U0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP glucuronosyltransferase ELISA kit

E01U0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

UXS1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2604102 1.0 ug DNA
EUR 154

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit

abx250710-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human GAD1/ Glutamate decarboxylase 1 ELISA Kit

E0966Hu 1 Kit
EUR 571

ELISA kit for Human Glutamate decarboxylase 1

EK3068 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Glutamate decarboxylase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GAD1(Glutamate decarboxylase 1) ELISA Kit

EH1433 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: Q99259
  • Alias: GAD1(Glutamate Decarboxylase 1)/GAD67/GAD25/Glutamate decarboxylase 67 kDa isoform
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Glutamate decarboxylase 1, GAD1 ELISA KIT

ELI-04161h 96 Tests
EUR 824

Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit

abx573942-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Adenosylmethionine Decarboxylase 1(AMD1)ELISA Kit

QY-E00878 96T
EUR 361

Human Glutamate decarboxylase 1(GAD1) ELISA kit

E01G0411-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamate decarboxylase 1(GAD1) ELISA kit

E01G0411-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamate decarboxylase 1(GAD1) ELISA kit

E01G0411-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

UXS1 Blocking Peptide

33R-5205 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UXS1 antibody, catalog no. 70R-7443

UXS1 Conjugated Antibody

C47406 100ul
EUR 397

UXS1 cloning plasmid

CSB-CL822754HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1263
  • Sequence: atggtgagcaaggcgctgctgcgcctcgtgtctgccgtcaaccgcaggaggatgaagctgctgctgggcatcgccttgctggcctacgtcgcctctgtttggggcaacttcgttaatatgaggtctatccaggaaaatggtgaactaaaaattgaaagcaagattgaagagatgg
  • Show more
Description: A cloning plasmid for the UXS1 gene.

UXS1 Polyclonal Antibody

A61710 100 µg
EUR 570.55
Description: Ask the seller for details

Human UDP-glucuronosyltransferase 1-6 (UGT1A6) ELISA Kit

abx250751-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human UDP-glucuronosyltransferase 1-6

EK3152 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human UDP-glucuronosyltransferase 1-6 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human UGT1A6/ UDP-glucuronosyltransferase 1-6 ELISA Kit

E2639Hu 1 Kit
EUR 605

Human UGT1A4/ UDP-glucuronosyltransferase 1-4 ELISA Kit

E2958Hu 1 Kit
EUR 605

Human UGT1A6(UDP-glucuronosyltransferase 1-6) ELISA Kit

EH1470 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P19224
  • Alias: UGT1A6/UDP-glucuronosyltransferase 1-6/UDPGT 1-6/UGT1-06/UGT1.6/UDP-glucuronosyltransferase 1A6/Phenol-metabolizing UDP-glucuronosyltransferase/UDP-glucuronosyltransferase 1-F/UGT-1F/UGT1F/GNT
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human UDP- glucuronosyltransferase 1- 9, UGT1A9 ELISA KIT

ELI-16714h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 8, UGT1A8 ELISA KIT

ELI-22230h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 5, UGT1A5 ELISA KIT

ELI-28832h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 6, UGT1A6 ELISA KIT

ELI-51196h 96 Tests
EUR 824

Human UDP-glucose:glycoprotein glucosyltransferase 1 (UGCGL1) ELISA Kit

abx384113-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human UDP- glucuronosyltransferase 1- 4, UGT1A4 ELISA KIT

ELI-40286h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 10, UGT1A10 ELISA KIT

ELI-40622h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 3, UGT1A3 ELISA KIT

ELI-36744h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 7, UGT1A7 ELISA KIT

ELI-36745h 96 Tests
EUR 824

Ornithine Decarboxylase-1 (ODC-1); Clone ODC1/485 (Concentrate)

RA0252-C.1 0.1 ml
EUR 125

UXS1 ORF Vector (Human) (pORF)

ORF011398 1.0 ug DNA
EUR 95

Human dopamine decarboxylase ELISA Kit

ELA-E1431h 96 Tests
EUR 824

Human Ornithine Decarboxylase ELISA kit

E01O0013-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ornithine Decarboxylase ELISA kit

E01O0013-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ornithine Decarboxylase ELISA kit

E01O0013-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine decarboxylase ELISA kit

E01D0232-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine decarboxylase ELISA kit

E01D0232-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine decarboxylase ELISA kit

E01D0232-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Rat Ugt1a1/ UDP-glucuronosyltransferase 1-1 ELISA Kit

E1021Ra 1 Kit
EUR 646

Mouse Ugt1a1/ UDP-glucuronosyltransferase 1-1 ELISA Kit

E1560Mo 1 Kit
EUR 632

Mouse UDP- glucuronosyltransferase 1- 1, Ugt1a1 ELISA KIT

ELI-04283m 96 Tests
EUR 865

Mouse UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit

abx516266-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit

abx516269-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human UDP glucuronosyltransferase II ELISA kit

E01U0020-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase II in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UXS1(UDP Glucuronate Decarboxylase 1) ELISA Kit