Human UXS1(UDP Glucuronate Decarboxylase 1) ELISA Kit
 ELISA Kit) Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit |
|
SEG906Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids. |
Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit |
|
SEG906Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids. |
Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit |
|
SEG906Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids. |
Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit |
|
4-SEG906Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as UDP Glucuronate Decarboxylase 1 elisa. Alternative names of the recognized antigen: UGD
- SDR6E1
- Short Chain Dehydrogenase/reductase Family 6E, Member 12
- UDP-glucuronic acid decarboxylase 1
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 CLIA Kit) Human UDP Glucuronate Decarboxylase 1 (UXS1) CLIA Kit |
|
20-abx495326 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human UXS1 (UDP Glucuronate Decarboxylase 1) |
|
ELK5293 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to UDP Glucuronate Decarboxylase 1 (UXS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
- Show more
|
|
Description: A sandwich ELISA kit for detection of UDP Glucuronate Decarboxylase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Human UDP- glucuronic acid decarboxylase 1, UXS1 ELISA KIT |
|
ELI-16868h |
Lifescience Market |
96 Tests |
EUR 824 |
 Antibody) UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody |
|
abx027193-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody |
|
abx027193-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody |
|
20-abx318312 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Mouse UDP- glucuronic acid decarboxylase 1, Uxs1 ELISA KIT |
|
ELI-22464m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Rat UDP-glucuronic acid decarboxylase 1 (UXS1) ELISA Kit |
|
abx392098-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse UDP-glucuronic acid decarboxylase 1 (UXS1) ELISA Kit |
|
abx390825-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
) ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1) |
|
KTE60076-48T |
Abbkine |
48T |
EUR 332 |
- UDP-glucuronate decarboxylase (UGD
- EC 4.1.1.35) catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans.
The topology of the deduced 420-amin
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1) |
|
KTE60076-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- UDP-glucuronate decarboxylase (UGD
- EC 4.1.1.35) catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans.
The topology of the deduced 420-amin
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1) |
|
KTE60076-96T |
Abbkine |
96T |
EUR 539 |
- UDP-glucuronate decarboxylase (UGD
- EC 4.1.1.35) catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans.
The topology of the deduced 420-amin
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Uxs1 ELISA Kit| Mouse UDP-glucuronic acid decarboxylase 1 ELISA |
|
EF016469 |
Lifescience Market |
96 Tests |
EUR 689 |
 Antibody (HRP)) UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (HRP) |
|
20-abx309025 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (FITC) |
|
20-abx309026 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (Biotin) |
|
20-abx309027 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Uxs1 ELISA Kit| Rat UDP-glucuronic acid decarboxylase 1 ELISA K |
|
EF019458 |
Lifescience Market |
96 Tests |
EUR 689 |
 Antibody) UDP-Glucuronate 5'-Epimerase (lspL) Antibody |
|
20-abx300281 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
) Rhizobium meliloti UDP-glucuronate 5'-epimerase (lspL) |
|
1-CSB-EP526307RKU |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 54.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Rhizobium meliloti UDP-glucuronate 5'-epimerase(lspL) expressed in E.coli |
 Antibody (HRP)) UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (HRP) |
|
20-abx300282 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (FITC) |
|
20-abx300283 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (Biotin) |
|
20-abx300284 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (OKCD01936)) UXS1 ELISA Kit (Human) (OKCD01936) |
|
OKCD01936 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose. Necessary for the biosynthesis of the core tetrasaccharide in glycosaminoglycan biosynthesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL |
 GAD1 iso1 Glutamate Decarboxylase 1 Isoform-1 Human Recombinant Protein |
|
PROTQ99259-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
|
Description: GAD1 iso1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 617 amino acids (1-594 a.a) and having a molecular mass of 69.3kDa. GAD1 iso1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
 ELISA Kit) Human UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit |
|
abx250749-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA kit for Human UDP-glucuronosyltransferase 1-1 |
|
EK3151 |
SAB |
96 tests |
EUR 553 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Human UDP-glucuronosyltransferase 1-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
 Human UGT1A1/ UDP-glucuronosyltransferase 1-1 ELISA Kit |
|
E2638Hu |
Sunlong |
1 Kit |
EUR 605 |
 ELISA Kit) Human UGT1A1(UDP-glucuronosyltransferase 1-1) ELISA Kit |
|
EH1469 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P22309
- Alias: UGT1A1/UDP-glucuronosyltransferase 1-1/UDPGT 1-1/bilirubin UDP-glucuronosyltransferase 1-1/UDP glucuronosyltransferase 1 family, polypeptide A1/UGT1*1/UGT1-01/UGT1.1/UDP-glucuronosyltransferas
- Show more
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
 Human UDP- glucuronosyltransferase 1- 1, UGT1A1 ELISA KIT |
|
ELI-04284h |
Lifescience Market |
96 Tests |
EUR 824 |
 UXS1 Antibody |
|
47406-100ul |
SAB |
100ul |
EUR 252 |
UXS1 Antibody |
|
1-CSB-PA822754LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against UXS1. Recognizes UXS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
 UXS1 antibody |
|
70R-7443 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal UXS1 antibody raised against the middle region of UXS1 |
 UXS1 siRNA |
|
20-abx905996 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UXS1 siRNA |
|
20-abx939302 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UXS1 siRNA |
|
20-abx939303 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Human UDP glucuronosyltransferase ELISA kit |
|
E01U0021-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human UDP glucuronosyltransferase ELISA kit |
|
E01U0021-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human UDP glucuronosyltransferase ELISA kit |
|
E01U0021-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 5-OMe-UDP trisodium salt |
|
B5568-1 |
ApexBio |
1 mg |
EUR 431 |
 ELISA kit) Human Glutamate decarboxylase 1(GAD1) ELISA kit |
|
E01G0411-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutamate decarboxylase 1(GAD1) ELISA kit |
|
E01G0411-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glutamate decarboxylase 1(GAD1) ELISA kit |
|
E01G0411-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit |
|
20-abx151611 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit |
|
abx250710-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 Human GAD1/ Glutamate decarboxylase 1 ELISA Kit |
|
E0966Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA kit for Human Glutamate decarboxylase 1 |
|
EK3068 |
SAB |
96 tests |
EUR 553 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Glutamate decarboxylase 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
 ELISA Kit) Human GAD1(Glutamate decarboxylase 1) ELISA Kit |
|
EH1433 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 1.563-100 ng/ml
- Uniprot ID: Q99259
- Alias: GAD1(Glutamate Decarboxylase 1)/GAD67/GAD25/Glutamate decarboxylase 67 kDa isoform
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
 Human Glutamate decarboxylase 1, GAD1 ELISA KIT |
|
ELI-04161h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit |
|
abx573942-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
ELISA Kit) Human Adenosylmethionine Decarboxylase 1(AMD1)ELISA Kit |
|
QY-E00878 |
Qayee Biotechnology |
96T |
EUR 361 |
 Human UXS1 shRNA Plasmid |
|
20-abx962770 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) UXS1 Recombinant Protein (Human) |
|
RP034192 |
ABM |
100 ug |
Ask for price |
 ELISA Kit) Human UDP-glucuronosyltransferase 1-6 (UGT1A6) ELISA Kit |
|
abx250751-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA kit for Human UDP-glucuronosyltransferase 1-6 |
|
EK3152 |
SAB |
96 tests |
EUR 553 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Human UDP-glucuronosyltransferase 1-6 in samples from serum, plasma, tissue homogenates and other biological fluids. |
 Human UGT1A6/ UDP-glucuronosyltransferase 1-6 ELISA Kit |
|
E2639Hu |
Sunlong |
1 Kit |
EUR 605 |
 Human UGT1A4/ UDP-glucuronosyltransferase 1-4 ELISA Kit |
|
E2958Hu |
Sunlong |
1 Kit |
EUR 605 |
 ELISA Kit) Human UGT1A6(UDP-glucuronosyltransferase 1-6) ELISA Kit |
|
EH1470 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P19224
- Alias: UGT1A6/UDP-glucuronosyltransferase 1-6/UDPGT 1-6/UGT1-06/UGT1.6/UDP-glucuronosyltransferase 1A6/Phenol-metabolizing UDP-glucuronosyltransferase/UDP-glucuronosyltransferase 1-F/UGT-1F/UGT1F/GNT
- Show more
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
 Human UDP- glucuronosyltransferase 1- 9, UGT1A9 ELISA KIT |
|
ELI-16714h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human UDP- glucuronosyltransferase 1- 8, UGT1A8 ELISA KIT |
|
ELI-22230h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human UDP- glucuronosyltransferase 1- 5, UGT1A5 ELISA KIT |
|
ELI-28832h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human UDP- glucuronosyltransferase 1- 6, UGT1A6 ELISA KIT |
|
ELI-51196h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit) Human UDP-glucose:glycoprotein glucosyltransferase 1 (UGCGL1) ELISA Kit |
|
abx384113-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Human UDP- glucuronosyltransferase 1- 4, UGT1A4 ELISA KIT |
|
ELI-40286h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human UDP- glucuronosyltransferase 1- 10, UGT1A10 ELISA KIT |
|
ELI-40622h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human UDP- glucuronosyltransferase 1- 3, UGT1A3 ELISA KIT |
|
ELI-36744h |
Lifescience Market |
96 Tests |
EUR 824 |
 Human UDP- glucuronosyltransferase 1- 7, UGT1A7 ELISA KIT |
|
ELI-36745h |
Lifescience Market |
96 Tests |
EUR 824 |
 with goat anti-rabbit HRP secondary antibody) ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
|
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
|
) mRNAExpress mRNA Synthesis kit (5 reactions) |
|
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 Human Ornithine Decarboxylase ELISA kit |
|
E01O0013-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ornithine Decarboxylase ELISA kit |
|
E01O0013-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ornithine Decarboxylase ELISA kit |
|
E01O0013-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human Dopamine decarboxylase ELISA kit |
|
E01D0232-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dopamine decarboxylase ELISA kit |
|
E01D0232-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dopamine decarboxylase ELISA kit |
|
E01D0232-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 ELISA Kit) Glutamate Decarboxylase 1 (GAD1) ELISA Kit |
|
abx595244-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
 (Target 1)) UXS1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2604102 |
ABM |
1.0 ug DNA |
EUR 154 |
 Human UDP glucuronosyltransferase II ELISA kit |
|
E01U0020-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase II in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human UDP glucuronosyltransferase II ELISA kit |
|
E01U0020-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase II in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human UDP glucuronosyltransferase II ELISA kit |
|
E01U0020-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase II in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Rat Ugt1a1/ UDP-glucuronosyltransferase 1-1 ELISA Kit |
|
E1021Ra |
Sunlong |
1 Kit |
EUR 646 |
 Mouse Ugt1a1/ UDP-glucuronosyltransferase 1-1 ELISA Kit |
|
E1560Mo |
Sunlong |
1 Kit |
EUR 632 |
 Mouse UDP- glucuronosyltransferase 1- 1, Ugt1a1 ELISA KIT |
|
ELI-04283m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Mouse UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit |
|
abx516266-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit |
|
abx516269-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
 UXS1 Blocking Peptide |
|
33R-5205 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UXS1 antibody, catalog no. 70R-7443 |
 UXS1 Conjugated Antibody |
|
C47406 |
SAB |
100ul |
EUR 397 |
 UXS1 cloning plasmid |
|
CSB-CL822754HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1263
- Sequence: atggtgagcaaggcgctgctgcgcctcgtgtctgccgtcaaccgcaggaggatgaagctgctgctgggcatcgccttgctggcctacgtcgcctctgtttggggcaacttcgttaatatgaggtctatccaggaaaatggtgaactaaaaattgaaagcaagattgaagagatgg
- Show more
|
|
Description: A cloning plasmid for the UXS1 gene. |
 UXS1 Polyclonal Antibody |
|
A61710 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
; Clone ODC1/485 (Concentrate)) Ornithine Decarboxylase-1 (ODC-1); Clone ODC1/485 (Concentrate) |
|
RA0252-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
) ELISA kit for Human GAD1 (Glutamate Decarboxylase 1) |
|
E-EL-H2395 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GAD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GAD1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human GAD1 (Glutamate Decarboxylase 1) in samples from Serum, Plasma, Cell supernatant |
 ELISA Kit) Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
DLR-OAZ1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in samples from tissue homogenates or other biological fluids. |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
DLR-OAZ1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in samples from tissue homogenates or other biological fluids. |
 ELISA Kit) Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
DLR-GAD1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
DLR-GAD1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in samples from tissue homogenates, cell lysates or other biological fluids. |
 autoantibody ELISA kit) Human Glutamate decarboxylase 1(GAD1) autoantibody ELISA kit |
|
CSB-EQ027987HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Qualitative indirect ELISA kit for measuring Human Glutamate decarboxylase 1 (GAD1) autoantibody in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Glutamate decarboxylase 1(GAD1) autoantibody ELISA kit |
|
1-CSB-EQ027987HU |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Qualitative indirect ELISA kit for measuring Human Glutamate decarboxylase 1(GAD1) autoantibody in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
20-abx152578 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 Human Ornithine decarboxylase antizyme 1, OAZ1 ELISA KIT |
|
ELI-44323h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA Kit) Human Ornithine Decarboxylase Antizyme 1(OAZ1)ELISA Kit |
|
QY-E02072 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
RDR-GAD1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
RDR-GAD1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
SEC685Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in Tissue homogenates and other biological fluids. |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
SEC685Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in Tissue homogenates and other biological fluids. |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
SEC685Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in Tissue homogenates and other biological fluids. |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
SEC685Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in Tissue homogenates and other biological fluids. |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
4-SEC685Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Ornithine Decarboxylase Antizyme 1 elisa. Alternative names of the recognized antigen: AZI
- OAZ
- ODC-Az
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
SEC904Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Decarboxylase 1, Brain (GAD1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
SEC904Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Decarboxylase 1, Brain (GAD1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
SEC904Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Decarboxylase 1, Brain (GAD1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
SEC904Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Decarboxylase 1, Brain (GAD1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
4-SEC904Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Glutamate Decarboxylase 1, Brain elisa. Alternative names of the recognized antigen: GAD67
- SCP
- 67 kDa glutamic acid decarboxylase
- Glutamate decarboxylase 67 kDa isoform
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
RD-GAD1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit |
|
RD-GAD1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
RDR-OAZ1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
RDR-OAZ1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
RD-OAZ1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit |
|
RD-OAZ1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 ELISA Kit) Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) ELISA Kit |
|
DLR-UGGT1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) ELISA Kit |
|
DLR-UGGT1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human UXS1(UDP Glucuronate Decarboxylase 1) ELISA Kit
