Human UXS1(UDP Glucuronate Decarboxylase 1) ELISA Kit

Human UXS1(UDP Glucuronate Decarboxylase 1) ELISA Kit

Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit

SEG906Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids.

Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit

SEG906Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids.

Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit

SEG906Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human UDP Glucuronate Decarboxylase 1 (UXS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in Tissue homogenates, cell lysates and other biological fluids.

Human UDP Glucuronate Decarboxylase 1 (UXS1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as UDP Glucuronate Decarboxylase 1 elisa. Alternative names of the recognized antigen: UGD
  • SDR6E1
  • Short Chain Dehydrogenase/reductase Family 6E, Member 12
  • UDP-glucuronic acid decarboxylase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human UDP Glucuronate Decarboxylase 1 (UXS1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human UDP Glucuronate Decarboxylase 1 (UXS1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human UXS1 (UDP Glucuronate Decarboxylase 1)

ELK5293 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to UDP Glucuronate Decarboxylase 1 (UXS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of UDP Glucuronate Decarboxylase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human UDP- glucuronic acid decarboxylase 1, UXS1 ELISA KIT

ELI-16868h 96 Tests
EUR 824

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody

abx027193-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody

abx027193-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse UDP- glucuronic acid decarboxylase 1, Uxs1 ELISA KIT

ELI-22464m 96 Tests
EUR 865

Rat UDP-glucuronic acid decarboxylase 1 (UXS1) ELISA Kit

abx392098-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse UDP-glucuronic acid decarboxylase 1 (UXS1) ELISA Kit

abx390825-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1)

KTE60076-48T 48T
EUR 332
  • UDP-glucuronate decarboxylase (UGD
  • EC catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans. The topology of the deduced 420-amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1)

KTE60076-5platesof96wells 5 plates of 96 wells
EUR 2115
  • UDP-glucuronate decarboxylase (UGD
  • EC catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans. The topology of the deduced 420-amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human UDP-glucuronic acid decarboxylase 1 (UXS1)

KTE60076-96T 96T
EUR 539
  • UDP-glucuronate decarboxylase (UGD
  • EC catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans. The topology of the deduced 420-amin
  • Show more
Description: Quantitative sandwich ELISA for measuring Human UDP-glucuronic acid decarboxylase 1 (UXS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Uxs1 ELISA Kit| Mouse UDP-glucuronic acid decarboxylase 1 ELISA

EF016469 96 Tests
EUR 689

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UDP-Glucuronic Acid Decarboxylase 1 (UXS1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Uxs1 ELISA Kit| Rat UDP-glucuronic acid decarboxylase 1 ELISA K

EF019458 96 Tests
EUR 689

UDP-Glucuronate 5'-Epimerase (lspL) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Rhizobium meliloti UDP-glucuronate 5'-epimerase (lspL)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rhizobium meliloti UDP-glucuronate 5'-epimerase(lspL) expressed in E.coli

UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UDP-Glucuronate 5'-Epimerase (LSPL) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Uxs1/ Rat Uxs1 ELISA Kit

ELI-17782r 96 Tests
EUR 886


EF005687 96 Tests
EUR 689

UXS1 ELISA Kit (Human) (OKCD01936)

OKCD01936 96 Wells
EUR 831
Description: Description of target: Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose. Necessary for the biosynthesis of the core tetrasaccharide in glycosaminoglycan biosynthesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.116 ng/mL

GAD1 iso1 Glutamate Decarboxylase 1 Isoform-1 Human Recombinant Protein

PROTQ99259-1 Regular: 20ug
EUR 317
Description: GAD1 iso1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 617 amino acids (1-594 a.a) and having a molecular mass of 69.3kDa. GAD1 iso1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit

abx250749-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human UDP-glucuronosyltransferase 1-1

EK3151 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human UDP-glucuronosyltransferase 1-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human UGT1A1/ UDP-glucuronosyltransferase 1-1 ELISA Kit

E2638Hu 1 Kit
EUR 605

Human UGT1A1(UDP-glucuronosyltransferase 1-1) ELISA Kit

EH1469 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P22309
  • Alias: UGT1A1/UDP-glucuronosyltransferase 1-1/UDPGT 1-1/bilirubin UDP-glucuronosyltransferase 1-1/UDP glucuronosyltransferase 1 family, polypeptide A1/UGT1*1/UGT1-01/UGT1.1/UDP-glucuronosyltransferas
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human UDP- glucuronosyltransferase 1- 1, UGT1A1 ELISA KIT

ELI-04284h 96 Tests
EUR 824

UXS1 Antibody

47406-100ul 100ul
EUR 252

UXS1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UXS1. Recognizes UXS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

UXS1 antibody

70R-7443 50 ug
EUR 467
Description: Rabbit polyclonal UXS1 antibody raised against the middle region of UXS1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human UDP glucuronosyltransferase ELISA kit

E01U0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP glucuronosyltransferase ELISA kit

E01U0021-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP glucuronosyltransferase ELISA kit

E01U0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

5-OMe-UDP trisodium salt

B5568-1 1 mg
EUR 431

Human Glutamate decarboxylase 1(GAD1) ELISA kit

E01G0411-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamate decarboxylase 1(GAD1) ELISA kit

E01G0411-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamate decarboxylase 1(GAD1) ELISA kit

E01G0411-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamate decarboxylase 1(GAD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit

abx250710-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human GAD1/ Glutamate decarboxylase 1 ELISA Kit

E0966Hu 1 Kit
EUR 571

ELISA kit for Human Glutamate decarboxylase 1

EK3068 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Glutamate decarboxylase 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GAD1(Glutamate decarboxylase 1) ELISA Kit

EH1433 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: Q99259
  • Alias: GAD1(Glutamate Decarboxylase 1)/GAD67/GAD25/Glutamate decarboxylase 67 kDa isoform
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Glutamate decarboxylase 1, GAD1 ELISA KIT

ELI-04161h 96 Tests
EUR 824

Human Glutamate Decarboxylase 1 (GAD1) ELISA Kit

abx573942-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Adenosylmethionine Decarboxylase 1(AMD1)ELISA Kit

QY-E00878 96T
EUR 361

Human UXS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UXS1 Recombinant Protein (Human)

RP034192 100 ug Ask for price

Human UDP-glucuronosyltransferase 1-6 (UGT1A6) ELISA Kit

abx250751-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human UDP-glucuronosyltransferase 1-6

EK3152 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human UDP-glucuronosyltransferase 1-6 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human UGT1A6/ UDP-glucuronosyltransferase 1-6 ELISA Kit

E2639Hu 1 Kit
EUR 605

Human UGT1A4/ UDP-glucuronosyltransferase 1-4 ELISA Kit

E2958Hu 1 Kit
EUR 605

Human UGT1A6(UDP-glucuronosyltransferase 1-6) ELISA Kit

EH1470 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P19224
  • Alias: UGT1A6/UDP-glucuronosyltransferase 1-6/UDPGT 1-6/UGT1-06/UGT1.6/UDP-glucuronosyltransferase 1A6/Phenol-metabolizing UDP-glucuronosyltransferase/UDP-glucuronosyltransferase 1-F/UGT-1F/UGT1F/GNT
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human UDP- glucuronosyltransferase 1- 9, UGT1A9 ELISA KIT

ELI-16714h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 8, UGT1A8 ELISA KIT

ELI-22230h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 5, UGT1A5 ELISA KIT

ELI-28832h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 6, UGT1A6 ELISA KIT

ELI-51196h 96 Tests
EUR 824

Human UDP-glucose:glycoprotein glucosyltransferase 1 (UGCGL1) ELISA Kit

abx384113-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human UDP- glucuronosyltransferase 1- 4, UGT1A4 ELISA KIT

ELI-40286h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 10, UGT1A10 ELISA KIT

ELI-40622h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 3, UGT1A3 ELISA KIT

ELI-36744h 96 Tests
EUR 824

Human UDP- glucuronosyltransferase 1- 7, UGT1A7 ELISA KIT

ELI-36745h 96 Tests
EUR 824

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Ornithine Decarboxylase ELISA kit

E01O0013-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ornithine Decarboxylase ELISA kit

E01O0013-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ornithine Decarboxylase ELISA kit

E01O0013-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine decarboxylase ELISA kit

E01D0232-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine decarboxylase ELISA kit

E01D0232-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine decarboxylase ELISA kit

E01D0232-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human dopamine decarboxylase ELISA Kit

ELA-E1431h 96 Tests
EUR 824

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Glutamate Decarboxylase 1 (GAD1) ELISA Kit

abx595244-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

UXS1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2604102 1.0 ug DNA
EUR 154

Human UDP glucuronosyltransferase II ELISA kit

E01U0020-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase II in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP glucuronosyltransferase II ELISA kit

E01U0020-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase II in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human UDP glucuronosyltransferase II ELISA kit

E01U0020-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human UDP glucuronosyltransferase II in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ugt1a1/ UDP-glucuronosyltransferase 1-1 ELISA Kit

E1021Ra 1 Kit
EUR 646

Mouse Ugt1a1/ UDP-glucuronosyltransferase 1-1 ELISA Kit

E1560Mo 1 Kit
EUR 632

Mouse UDP- glucuronosyltransferase 1- 1, Ugt1a1 ELISA KIT

ELI-04283m 96 Tests
EUR 865

Mouse UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit

abx516266-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse UDP-glucuronosyltransferase 1-1 (UGT1A1) ELISA Kit

abx516269-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

UXS1 Blocking Peptide

33R-5205 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UXS1 antibody, catalog no. 70R-7443

UXS1 Conjugated Antibody

C47406 100ul
EUR 397

UXS1 cloning plasmid

CSB-CL822754HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1263
  • Sequence: atggtgagcaaggcgctgctgcgcctcgtgtctgccgtcaaccgcaggaggatgaagctgctgctgggcatcgccttgctggcctacgtcgcctctgtttggggcaacttcgttaatatgaggtctatccaggaaaatggtgaactaaaaattgaaagcaagattgaagagatgg
  • Show more
Description: A cloning plasmid for the UXS1 gene.

UXS1 Polyclonal Antibody

A61710 100 µg
EUR 570.55
Description: Ask the seller for details

Ornithine Decarboxylase-1 (ODC-1); Clone ODC1/485 (Concentrate)

RA0252-C.1 0.1 ml
EUR 125

ELISA kit for Human GAD1 (Glutamate Decarboxylase 1)

E-EL-H2395 1 plate of 96 wells
EUR 534
  • Gentaur's GAD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GAD1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GAD1 (Glutamate Decarboxylase 1) in samples from Serum, Plasma, Cell supernatant

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

DLR-OAZ1-Hu-48T 48T
EUR 517
  • Should the Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in samples from tissue homogenates or other biological fluids.

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

DLR-OAZ1-Hu-96T 96T
EUR 673
  • Should the Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in samples from tissue homogenates or other biological fluids.

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

DLR-GAD1-Hu-48T 48T
EUR 517
  • Should the Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

DLR-GAD1-Hu-96T 96T
EUR 673
  • Should the Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate decarboxylase 1(GAD1) autoantibody ELISA kit

CSB-EQ027987HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human Glutamate decarboxylase 1 (GAD1) autoantibody in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Glutamate decarboxylase 1(GAD1) autoantibody ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human Glutamate decarboxylase 1(GAD1) autoantibody in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ornithine decarboxylase antizyme 1, OAZ1 ELISA KIT

ELI-44323h 96 Tests
EUR 824

Human Ornithine Decarboxylase Antizyme 1(OAZ1)ELISA Kit

QY-E02072 96T
EUR 361

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

RDR-GAD1-Hu-48Tests 48 Tests
EUR 544

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

RDR-GAD1-Hu-96Tests 96 Tests
EUR 756

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

SEC685Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in Tissue homogenates and other biological fluids.

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

SEC685Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in Tissue homogenates and other biological fluids.

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

SEC685Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in Tissue homogenates and other biological fluids.

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

SEC685Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in Tissue homogenates and other biological fluids.

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ornithine Decarboxylase Antizyme 1 elisa. Alternative names of the recognized antigen: AZI
  • OAZ
  • ODC-Az
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ornithine Decarboxylase Antizyme 1 (OAZ1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

SEC904Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Decarboxylase 1, Brain (GAD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in Tissue homogenates, cell lysates and other biological fluids.

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

SEC904Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Decarboxylase 1, Brain (GAD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in Tissue homogenates, cell lysates and other biological fluids.

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

SEC904Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Decarboxylase 1, Brain (GAD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in Tissue homogenates, cell lysates and other biological fluids.

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

SEC904Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutamate Decarboxylase 1, Brain (GAD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in Tissue homogenates, cell lysates and other biological fluids.

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glutamate Decarboxylase 1, Brain elisa. Alternative names of the recognized antigen: GAD67
  • SCP
  • 67 kDa glutamic acid decarboxylase
  • Glutamate decarboxylase 67 kDa isoform
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutamate Decarboxylase 1, Brain (GAD1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

RD-GAD1-Hu-48Tests 48 Tests
EUR 521

Human Glutamate Decarboxylase 1, Brain (GAD1) ELISA Kit

RD-GAD1-Hu-96Tests 96 Tests
EUR 723

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

RDR-OAZ1-Hu-48Tests 48 Tests
EUR 544

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

RDR-OAZ1-Hu-96Tests 96 Tests
EUR 756

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

RD-OAZ1-Hu-48Tests 48 Tests
EUR 521

Human Ornithine Decarboxylase Antizyme 1 (OAZ1) ELISA Kit

RD-OAZ1-Hu-96Tests 96 Tests
EUR 723

Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) ELISA Kit

DLR-UGGT1-Hu-48T 48T
EUR 517
  • Should the Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) ELISA Kit

DLR-UGGT1-Hu-96T 96T
EUR 673
  • Should the Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human UDP-Glucose Glycoprotein Glucosyltransferase 1 (UGGT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human UXS1(UDP Glucuronate Decarboxylase 1) ELISA Kit