Human LPIN1(Lipin 1) ELISA Kit

Human LPIN1(Lipin 1) ELISA Kit

Mouse Lipin 1 (LPIN1) ELISA Kit
RDR-LPIN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Lipin 1 (LPIN1) ELISA Kit
RDR-LPIN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Lipin 1 (LPIN1) ELISA Kit
RDR-LPIN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Mouse Lipin 1 (LPIN1) ELISA Kit
RD-LPIN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Lipin 1 (LPIN1) ELISA Kit
RD-LPIN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Lipin 1 (LPIN1) ELISA Kit
RD-LPIN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Lipin 1 (LPIN1) ELISA Kit
RD-LPIN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Lipin 1 (LPIN1)
RA25079	Neuromics	100 ul	EUR 461

Human Lipin 1 (LPIN1) ELISA Kit
20-abx258604	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Lipin 1(LPIN1)ELISA Kit
QY-E00226	Qayee Biotechnology	96T	EUR 361

Human Lipin 1 (LPIN1) ELISA Kit
SEG501Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit
SEG501Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit
SEG501Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit
SEG501Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Human Lipin 1 (LPIN1) ELISA Kit
4-SEG501Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lipin 1 (LPIN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Lipin 1 (LPIN1) ELISA Kit
20-abx155786	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Lipin 1 (LPIN1) ELISA Kit
20-abx154329	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Lipin 1 (LPIN1) ELISA Kit
SEG501Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit
SEG501Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit
SEG501Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit
SEG501Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Lipin 1 (LPIN1) in Tissue homogenates and other biological fluids.

Mouse Lipin 1 (LPIN1) ELISA Kit
4-SEG501Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Lipin 1 (LPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Lipin 1 (LPIN1) ELISA Kit
SEG501Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit
SEG501Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit
SEG501Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit
SEG501Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Lipin 1 (LPIN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Lipin 1 (LPIN1) in tissue homogenates, cell lysates and other biological fluids.

Rat Lipin 1 (LPIN1) ELISA Kit
4-SEG501Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Lipin 1 elisa. Alternative names of the recognized antigen: Phosphatidate phosphatase LPIN1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Lipin 1 (LPIN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Lipin 1 (LPIN1) Antibody
20-abx177375	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Lipin 1 (LPIN1) Antibody
20-abx177376	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Lipin 1 (LPIN1) Antibody
20-abx177377	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Lipin 1 (LPIN1) Antibody
20-abx173371	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Lipin 1 (LPIN1) Antibody
abx431255-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

ELISA kit for Human LPIN1 (Lipin 1)
ELK5420	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Lipin 1 (LPIN1) CLIA Kit
20-abx495221	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Rat LPIN1 (Lipin 1)
ELK6423	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse LPIN1 (Lipin 1)
ELK6460	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lipin 1 (LPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lipin 1 (LPIN1). N Show more
Description: A sandwich ELISA kit for detection of Lipin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Lipin 1 (LPIN1) CLIA Kit
20-abx495222	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Lipin 1 (LPIN1) CLIA Kit
20-abx495223	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Lipin 1 (LPIN1) Protein
20-abx654202	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Lipin 1 (LPIN1) Protein
20-abx654203	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Lipin 1 (LPIN1) Protein
20-abx654204	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Polyclonal LPIN1 / Lipin 1 Antibody (C-Terminus)
APR08260G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPIN1 / Lipin 1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Phosphatidate phosphatase LPIN1, LPIN1 ELISA KIT
ELI-42202h	Lifescience Market	96 Tests	EUR 824

Human Lipin ELISA kit
E01L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipin ELISA kit
E01L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lipin ELISA kit
E01L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

LPIN1 ELISA KIT|Human
EF005209	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)
KTE61788-48T	Abbkine	48T	EUR 332
Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)
KTE61788-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidate phosphatase LPIN1 (LPIN1)
KTE61788-96T	Abbkine	96T	EUR 539
Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Phosphatidate phosphatase LPIN1, Lpin1 ELISA KIT
ELI-12626m	Lifescience Market	96 Tests	EUR 865

Rat Lipin ELISA kit
E02L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Lipin ELISA kit
E02L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Lipin ELISA kit
E02L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Lipin ELISA kit
E04L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Lipin ELISA kit
E04L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Lipin ELISA kit
E04L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lipin ELISA kit
E03L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lipin ELISA kit
E03L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lipin ELISA kit
E03L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Lipin ELISA kit
E06L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Lipin ELISA kit
E06L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Lipin ELISA kit
E06L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Lipin ELISA kit
E08L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Lipin ELISA kit
E08L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Lipin ELISA kit
E08L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Lipin ELISA kit
E07L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Lipin ELISA kit
E07L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Lipin ELISA kit
E07L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Lipin ELISA kit
E09L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Lipin ELISA kit
E09L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Lipin ELISA kit
E09L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

LPIN1 ELISA Kit (Human) (OKCD04380)
OKCD04380	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.43 ng/mL

Lipin 1 antibody
70R-3204	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Lipin 1 antibody raised against the N terminal of LPIN1

Lipin 1 Antibody
49921-100ul	SAB	100ul	EUR 333

Lipin 1 Antibody
49921-50ul	SAB	50ul	EUR 239

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)
KTE71164-48T	Abbkine	48T	EUR 332
Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)
KTE71164-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Phosphatidate phosphatase LPIN1 (LPIN1)
KTE71164-96T	Abbkine	96T	EUR 539
Lipin-1 has phosphatidate phosphatase activity.This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions Show more
Description: Quantitative sandwich ELISA for measuring Mouse Phosphatidate phosphatase LPIN1 (LPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Lpin1 ELISA Kit| Mouse Phosphatidate phosphatase LPIN1 ELISA Ki
EF015392	Lifescience Market	96 Tests	EUR 689

Human Lipin 2 (LPIN2) ELISA Kit
abx388300-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Lipin 3(LPIN3)ELISA Kit
QY-E00224	Qayee Biotechnology	96T	EUR 361

Human Lipin 2(LPIN2)ELISA Kit
QY-E00225	Qayee Biotechnology	96T	EUR 361

Guinea pig Lipin ELISA kit
E05L0546-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Lipin ELISA kit
E05L0546-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Lipin ELISA kit
E05L0546-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Lipin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Lipin 1 Blocking Peptide
33R-8579	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LPIN1 antibody, catalog no. 70R-3204

Lipin 1 Conjugated Antibody
C49921	SAB	100ul	EUR 397

Anti-Lipin 1 (3D9)
YF-MA17815	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Lipin 1

LPIN1 ELISA Kit (Rat) (OKCD04508)
OKCD04508	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.127 ng/mL

LPIN1 ELISA Kit (Mouse) (OKCD08947)
OKCD08947	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Plays important roles in controlling the metabolism of fatty acids at differents levels. Acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis. Acts also as nuclear transcriptional coactivator for PPARGC1A/PPARA regulatory pathway to modulate lipid metabolism gene expression. Is involved in adipocyte differentiation. Isoform 1 is recruited at the mitochondrion outer membrane and is involved in mitochondrial fission by converting phosphatidic acid to diacylglycerol.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.051ng/mL

LPIN1 ELISA Kit (Mouse) (OKDD00738)
OKDD00738	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Plays important roles in controlling the metabolism of fatty acids at differents levels. acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis. acts also as nuclear transcriptional coactivator for ppargc1a/ppara regulatory pathway to modulate lipid metabolism gene expression. is involved in adipocyte differentiation. isoform 1 is recruited at the mitochondrion outer membrane and is involved in mitochondrial fission by converting phosphatidic acid to diacylglycerol.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.051 ng/mL

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody
20-abx006238	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody
abx038051-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Phosphatidate Phosphatase LPIN1 (LPIN1) Antibody
20-abx321300	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

LPIN1 Antibody
47149-100ul	SAB	100ul	EUR 252

LPIN1 Antibody
39971-100ul	SAB	100ul	EUR 390

LPIN1 Antibody
1-CSB-PA614805ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LPIN1. Recognizes LPIN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LPIN1 Antibody
DF7924	Affbiotech	200ul	EUR 304
Description: LPIN1 Antibody detects endogenous levels of total LPIN1.

LPIN1 Antibody
AF7585	Affbiotech	200ul	EUR 376
Description: LPIN1 Antibody detects endogenous levels of LPIN1.

LPIN1 siRNA
20-abx922769	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LPIN1 siRNA
20-abx922770	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LPIN1 Antibody
ABD7924	Lifescience Market	100 ug	EUR 438

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Anti-Lipin 1 (Internal) antibody
STJ71014	St John's Laboratory	100 µg	EUR 260

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human LPIN1 shRNA Plasmid
20-abx958058	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Lipin 2 antibody
70R-12128	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal Lipin 2 antibody

Lipin 2 Antibody
3832-100	Biovision		EUR 316

Lipin 2 Antibody
3832-30T	Biovision		EUR 146

Lipin 3 Antibody
abx432932-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

LPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1227102	ABM	1.0 ug DNA	EUR 154

Monoclonal Lipin-1 Antibody, Clone: EPR3725
APR08236G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human Lipin-1. The antibodies are raised in Rabbit and are from clone EPR3725. This antibody is applicable in WB, IHC and IF

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

LPIN1 Rabbit pAb
A14111-100ul	Abclonal	100 ul	EUR 308

LPIN1 Rabbit pAb
A14111-200ul	Abclonal	200 ul	EUR 459

LPIN1 Rabbit pAb
A14111-20ul	Abclonal	20 ul	EUR 183

LPIN1 Rabbit pAb
A14111-50ul	Abclonal	50 ul	EUR 223

LPIN1 Blocking Peptide
DF7924-BP	Affbiotech	1mg	EUR 195

LPIN1 Blocking Peptide
AF7585-BP	Affbiotech	1mg	EUR 195

LPIN1 Conjugated Antibody
C47149	SAB	100ul	EUR 397

Polyclonal LPIN1 Antibody
APR08261G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPIN1 . This antibody is tested and proven to work in the following applications:

LPIN1 cloning plasmid
CSB-CL614805HU-10ug	Cusabio	10ug	EUR 859
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2673 Sequence: atgaattacgtggggcagttagccggccaggtgtttgtcaccgtgaaggagctctacaaggggctgaatcccgccacactctcagggtgcattgacatcattgtcatccgccagcccaatggaaacctccaatgctcccctttccacgtccgctttgggaagatgggggtcctgc Show more
Description: A cloning plasmid for the LPIN1 gene.

LPIN1 Rabbit pAb
A8486-100ul	Abclonal	100 ul	EUR 308

LPIN1 Rabbit pAb
A8486-200ul	Abclonal	200 ul	EUR 459

LPIN1 Rabbit pAb
A8486-20ul	Abclonal	20 ul	EUR 183

LPIN1 Rabbit pAb
A8486-50ul	Abclonal	50 ul	EUR 223

LPIN1 Polyclonal Antibody
ABP59136-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein Applications tips:
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein

LPIN1 Polyclonal Antibody
ABP59136-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein Applications tips:
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein

LPIN1 Polyclonal Antibody
ABP59136-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LPIN1 protein Applications tips:
Description: A polyclonal antibody for detection of LPIN1 from Human, Mouse. This LPIN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPIN1 protein

LPIN1 Polyclonal Antibody
ES10897-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LPIN1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LPIN1 Polyclonal Antibody
ES10897-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LPIN1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-LPIN1 antibody
STJ110784	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined.

Anti-LPIN1 antibody
STJ116046	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined.

Anti-LPIN1 antibody
STJ192055	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LPIN1

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

LPIN1 ORF Vector (Human) (pORF)
ORF006053	ABM	1.0 ug DNA	EUR 95

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Lipin 2 Blocking Peptide
33R-10945	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Lipin 2 antibody, catalog no. 70R-12128

Lipin 2 Blocking Peptide
3832BP-50	Biovision		EUR 153

Polyclonal Lipin 2 Antibody
APR00210G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Lipin 2 . This antibody is tested and proven to work in the following applications:

Lipin 2 (LPIN2) Antibody
20-abx113523	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Lipin 2 (LPIN2) Antibody
abx034008-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Lipin 2 (LPIN2) Antibody
abx034008-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Lipin 2 (LPIN2) Antibody
abx234830-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Lipin 2 (LPIN2) Antibody
abx432931-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Anti-Lipin 2 antibody
STJ70666	St John's Laboratory	100 µg	EUR 260

Anti-Lipin 3 antibody
STJ71015	St John's Laboratory	100 µg	EUR 359

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Polyclonal Lipin 1 (Internal) Antibody (internal region)
APR08234G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Lipin 1 (Internal) (internal region). This antibody is tested and proven to work in the following applications:

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

LPIN1 (Phospho-Thr14) Antibody
12950-100ul	SAB	100ul	EUR 252

LPIN1 (Phospho-Thr14) Antibody
12950-50ul	SAB	50ul	EUR 187

Phospho-LPIN1(Thr14) Antibody
AF7085	Affbiotech	200ul	EUR 376
Description: Phospho-LPIN1(Thr14) Antibody detects endogenous levels of LPIN1 only when phosphorylated at Thr14.

Mouse LPIN1 shRNA Plasmid
20-abx970363	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Lpin1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5026902	ABM	1.0 ug DNA	EUR 154

Lpin1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7617902	ABM	1.0 ug DNA	EUR 154

LPIN1 sgRNA CRISPR Lentivector set (Human)
K1227101	ABM	3 x 1.0 ug	EUR 339

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit
EL3502-1	AssayPro	96 Well Plate	EUR 477

Human TGF-beta-1 AssayMax ELISA Kit
ET3102-1	AssayPro	96 Well Plate	EUR 477

Human PAI-1/tPA AssayMax ELISA Kit
EP1105-1	AssayPro	96 Well Plate	EUR 417

Rabbit Anti-Mouse Lipin-1 IgG #1, Aff. Pure
LPN11-A	Alpha Diagnostics	100 ug	EUR 482

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EI2200-1	AssayPro	96 Well Plate	EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit
EI2301-1	AssayPro	96 Well Plate	EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit
EP1100-1	AssayPro	96 Well Plate	EUR 417

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit
EC5752-1	AssayPro	96 Well Plate	EUR 477

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5001-1	AssayPro	96 Well Plate	EUR 417

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit
EA5101-1	AssayPro	96 Well Plate	EUR 417

Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit
EA5501-1	AssayPro	96 Well Plate	EUR 417

Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit
EE2702-1	AssayPro	96 Well Plate	EUR 477

Human Glutathione Transferase zeta 1 AssayMax ELISA Kit
EG2350-1	AssayPro	96 Well Plate	EUR 477

Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit
EG3928-1	AssayPro	96 Well Plate	EUR 477

Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit
EM5110-1	AssayPro	96 Well Plate	EUR 396

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1	AssayPro	96 Well Plate	EUR 417

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1	AssayPro	96 Well Plate	EUR 477

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Mouse Lipin-1 Control/blocking peptide control/blocking peptide #1
LPN11-P	Alpha Diagnostics	100 ug	EUR 164

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Human LPIN1(Lipin 1) ELISA Kit