Human JTB(Jumping Translocation Breakpoint Protein) ELISA Kit

Human JTB(Jumping Translocation Breakpoint Protein) ELISA Kit

Human Jumping Translocation Breakpoint Protein (JTB) ELISA Kit
SEJ873Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jumping Translocation Breakpoint Protein (JTB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jumping Translocation Breakpoint Protein (JTB) in Tissue homogenates, cell lysates and other biological fluids.

Human Jumping Translocation Breakpoint Protein (JTB) ELISA Kit
SEJ873Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jumping Translocation Breakpoint Protein (JTB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jumping Translocation Breakpoint Protein (JTB) in Tissue homogenates, cell lysates and other biological fluids.

Human Jumping Translocation Breakpoint Protein (JTB) ELISA Kit
SEJ873Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jumping Translocation Breakpoint Protein (JTB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jumping Translocation Breakpoint Protein (JTB) in Tissue homogenates, cell lysates and other biological fluids.

Human Jumping Translocation Breakpoint Protein (JTB) ELISA Kit
SEJ873Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jumping Translocation Breakpoint Protein (JTB) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jumping Translocation Breakpoint Protein (JTB) in Tissue homogenates, cell lysates and other biological fluids.

Human Jumping Translocation Breakpoint Protein (JTB) ELISA Kit
4-SEJ873Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Jumping Translocation Breakpoint Protein elisa. Alternative names of the recognized antigen: PAR B PAR HJTB hJT Prostate Androgen-Regulated Gene
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jumping Translocation Breakpoint Protein (JTB) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

JTB Jumping Translocation Breakpoint Human Recombinant Protein
PROTO76095	BosterBio	Regular: 10ug	EUR 317
Description: JTB Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 98 amino acids (31-105 a.a.) and having a molecular mass of 10.7kDa.;JTB is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Jumping Translocation Breakpoint Protein (JTB) CLIA Kit
20-abx495801	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human JTB (Jumping Translocation Breakpoint Protein)
ELK5305	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jumping Translocation Breakpoint Protein (JTB). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody Show more
Description: A sandwich ELISA kit for detection of Jumping Translocation Breakpoint Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Protein JTB, JTB ELISA KIT
ELI-28046h	Lifescience Market	96 Tests	EUR 824

Human Protein JTB(JTB) ELISA kit
CSB-EL011970HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein JTB (JTB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein JTB(JTB) ELISA kit
1-CSB-EL011970HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein JTB(JTB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Protein JTB (JTB) ELISA Kit
abx391514-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Protein JTB (JTB) ELISA Kit
abx389672-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Protein JTB, Jtb ELISA KIT
ELI-38140m	Lifescience Market	96 Tests	EUR 865

Jtb ELISA Kit| Rat Protein JTB ELISA Kit
EF018872	Lifescience Market	96 Tests	EUR 689

Jtb ELISA Kit| Mouse Protein JTB ELISA Kit
EF015306	Lifescience Market	96 Tests	EUR 689

Jtb/ Rat Jtb ELISA Kit
ELI-13634r	Lifescience Market	96 Tests	EUR 886

Protein JTB (JTB) Protein
20-abx262811	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

JTB ELISA KIT|Human
EF005166	Lifescience Market	96 Tests	EUR 689

Protein JTB (JTB) Antibody
20-abx126026	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protein JTB (JTB) Antibody
abx036039-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Brugia malayi Protein JTB (JTB)
1-CSB-EP011970BMV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 24.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Brugia malayi Protein JTB(JTB),partial expressed in E.coli

JTB ELISA Kit (Human) (OKCD02022)
OKCD02022	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Required for normal cytokinesis during mitosis. Plays a role in the regulation of cell proliferation. May be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly. Increases AURKB activity. Inhibits apoptosis induced by TGFB1. Overexpression induces swelling of mitochondria and reduces mitochondrial membrane potential.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.056 ng/mL

JTB ELISA Kit (Human) (OKCA02135)
OKCA02135	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Required for normal cytokinesis during mitosis. Plays a role in the regulation of cell proliferation. May be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly. Increases AURKB activity. Inhibits apoptosis induced by TGFB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.68 pg/mL

JTB Recombinant Protein (Human)
RP016504	ABM	100 ug	Ask for price

JTB Recombinant Protein (Human)
RP016507	ABM	100 ug	Ask for price

Human Translocation protein SEC62(SEC62) ELISA kit
E01T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Translocation protein SEC62(SEC62) ELISA kit
E01T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Translocation protein SEC62(SEC62) ELISA kit
E01T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Translocation protein SEC62, SEC62 ELISA KIT
ELI-53220h	Lifescience Market	96 Tests	EUR 824

Human Translocation protein SEC62 (SEC62) ELISA Kit
abx385488-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Translocation protein SEC63 (SEC63) ELISA Kit
abx383092-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Translocation Protein 1(TLOC1)ELISA Kit
QY-E00424	Qayee Biotechnology	96T	EUR 361

Human Breakpoint cluster region protein(BCR) ELISA kit
E01B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Breakpoint cluster region protein(BCR) ELISA kit
E01B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Breakpoint cluster region protein(BCR) ELISA kit
E01B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Breakpoint cluster region protein, BCR ELISA KIT
ELI-24482h	Lifescience Market	96 Tests	EUR 824

Human Breakpoint Cluster Region Protein (BCR) ELISA Kit
20-abx386034	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Translocation protein SEC63 homolog, SEC63 ELISA KIT
ELI-53221h	Lifescience Market	96 Tests	EUR 824

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

JTB Antibody
39646-100ul	SAB	100ul	EUR 390

JTB Antibody
DF8670	Affbiotech	200ul	EUR 304
Description: JTB Antibody detects endogenous levels of total JTB.

JTB Antibody
1-CSB-PA006742	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against JTB. Recognizes JTB from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

JTB siRNA
20-abx902753	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JTB siRNA
20-abx921069	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JTB siRNA
20-abx921070	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JTB Antibody
ABD8670	Lifescience Market	100 ug	EUR 438

pOTB7-JTB
PVT18306	Lifescience Market	2 ug	EUR 231

anti-JTB
YF-PA17288	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to JTB

anti-JTB
YF-PA27490	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to JTB

anti-JTB
YF-PA25689	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to JTB

Rat Translocation protein SEC62(SEC62) ELISA kit
E02T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Translocation protein SEC62(SEC62) ELISA kit
E02T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Translocation protein SEC62(SEC62) ELISA kit
E02T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Translocation protein SEC62(SEC62) ELISA kit
E04T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Translocation protein SEC62(SEC62) ELISA kit
E04T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Translocation protein SEC62(SEC62) ELISA kit
E04T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocation protein SEC62(SEC62) ELISA kit
E03T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocation protein SEC62(SEC62) ELISA kit
E03T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocation protein SEC62(SEC62) ELISA kit
E03T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocation protein SEC62(SEC62) ELISA kit
E08T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocation protein SEC62(SEC62) ELISA kit
E08T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Translocation protein SEC62(SEC62) ELISA kit
E08T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocation protein SEC62(SEC62) ELISA kit
E07T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocation protein SEC62(SEC62) ELISA kit
E07T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Translocation protein SEC62(SEC62) ELISA kit
E07T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocation protein SEC62(SEC62) ELISA kit
E09T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocation protein SEC62(SEC62) ELISA kit
E09T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Translocation protein SEC62(SEC62) ELISA kit
E09T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocation protein SEC62(SEC62) ELISA kit
E06T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocation protein SEC62(SEC62) ELISA kit
E06T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Translocation protein SEC62(SEC62) ELISA kit
E06T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Translocation protein SEC62, SEC62 ELISA KIT
ELI-13427c	Lifescience Market	96 Tests	EUR 928

Mouse Translocation protein SEC62, Sec62 ELISA KIT
ELI-53010m	Lifescience Market	96 Tests	EUR 865

Mouse Translocation protein SEC62 (SEC62) ELISA Kit
abx390778-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

JTB protein (His tag)
80R-3915	Fitzgerald	20 ug	EUR 327
Description: Purified recombinant JTB protein (His tag)

JTB Recombinant Protein (Rat)
RP206570	ABM	100 ug	Ask for price

JTB Recombinant Protein (Mouse)
RP144776	ABM	100 ug	Ask for price

Mouse Breakpoint cluster region protein(BCR) ELISA kit
E03B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Breakpoint cluster region protein(BCR) ELISA kit
E03B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Breakpoint cluster region protein(BCR) ELISA kit
E03B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Breakpoint cluster region protein(BCR) ELISA kit
E06B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Breakpoint cluster region protein(BCR) ELISA kit
E06B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Breakpoint cluster region protein(BCR) ELISA kit
E06B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Breakpoint cluster region protein(BCR) ELISA kit
E04B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Breakpoint cluster region protein(BCR) ELISA kit
E04B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Breakpoint cluster region protein(BCR) ELISA kit
E04B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Breakpoint cluster region protein(BCR) ELISA kit
E02B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Breakpoint cluster region protein(BCR) ELISA kit
E02B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Breakpoint cluster region protein(BCR) ELISA kit
E02B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Breakpoint cluster region protein(BCR) ELISA kit
E08B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Breakpoint cluster region protein(BCR) ELISA kit
E08B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Breakpoint cluster region protein(BCR) ELISA kit
E08B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Breakpoint cluster region protein(BCR) ELISA kit
E07B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Breakpoint cluster region protein(BCR) ELISA kit
E07B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Breakpoint cluster region protein(BCR) ELISA kit
E07B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Breakpoint cluster region protein(BCR) ELISA kit
E09B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Breakpoint cluster region protein(BCR) ELISA kit
E09B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Breakpoint cluster region protein(BCR) ELISA kit
E09B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Breakpoint cluster region protein, Bcr ELISA KIT
ELI-24483m	Lifescience Market	96 Tests	EUR 865

Mouse Breakpoint Cluster Region Protein (BCR) ELISA Kit
abx388709-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Sec62 ELISA Kit| Mouse Translocation protein SEC62 ELISA Kit
EF016421	Lifescience Market	96 Tests	EUR 689

SEC62 ELISA Kit| chicken Translocation protein SEC62 ELISA Kit
EF012543	Lifescience Market	96 Tests	EUR 689

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
DLR-TRAM1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Translocation Associated Membrane Protein 1 (TRAM1) in samples from tissue homogenates or other biological fluids.

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
DLR-TRAM1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Translocation Associated Membrane Protein 1 (TRAM1) in samples from tissue homogenates or other biological fluids.

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
20-abx153372	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
RDR-TRAM1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
RDR-TRAM1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
RD-TRAM1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
RD-TRAM1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
SEF824Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocation Associated Membrane Protein 1 (TRAM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocation Associated Membrane Protein 1 (TRAM1) in Tissue homogenates and other biological fluids.

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
SEF824Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocation Associated Membrane Protein 1 (TRAM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocation Associated Membrane Protein 1 (TRAM1) in Tissue homogenates and other biological fluids.

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
SEF824Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocation Associated Membrane Protein 1 (TRAM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocation Associated Membrane Protein 1 (TRAM1) in Tissue homogenates and other biological fluids.

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
SEF824Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Translocation Associated Membrane Protein 1 (TRAM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Translocation Associated Membrane Protein 1 (TRAM1) in Tissue homogenates and other biological fluids.

Human Translocation Associated Membrane Protein 1 (TRAM1) ELISA Kit
4-SEF824Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Translocation Associated Membrane Protein 1 elisa. Alternative names of the recognized antigen: TRAM TRAMP Translocating chain-associated membrane protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Translocation Associated Membrane Protein 1 (TRAM1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Recombinant human Translocation protein SEC62
P2293	FN Test	100ug	Ask for price
Uniprot ID: Q99442 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Translocation protein SEC62

Human JTB shRNA Plasmid
20-abx957428	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Active breakpoint cluster region related protein(ABR) ELISA kit
E01A1163-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Active breakpoint cluster region related protein(ABR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Active breakpoint cluster region related protein(ABR) ELISA kit
E01A1163-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Active breakpoint cluster region related protein(ABR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Active breakpoint cluster region related protein(ABR) ELISA kit
E01A1163-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Active breakpoint cluster region related protein(ABR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Active Breakpoint Cluster Region-Related Protein (ABR) ELISA Kit
abx384544-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Breakpoint Cluster Region (BCR) Protein
20-abx168904	Abbexa	EUR 634.00 EUR 272.00 EUR 1929.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Guinea pig Translocation protein SEC62(SEC62) ELISA kit
E05T0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Translocation protein SEC62(SEC62) ELISA kit
E05T0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Translocation protein SEC62(SEC62) ELISA kit
E05T0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Translocation protein SEC62(SEC62) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Translocation protein SEC63 homolog, Sec63 ELISA KIT
ELI-41598m	Lifescience Market	96 Tests	EUR 865

Human B cell translocation gene 1 ELISA kit
E01B1009--192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human B cell translocation gene 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human B cell translocation gene 1 ELISA kit
E01B1009--48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human B cell translocation gene 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human B cell translocation gene 1 ELISA kit
E01B1009--96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human B cell translocation gene 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ETV6(ETS translocation variant 6) ELISA Kit
EH8324	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Translocation Associated Notch Homolog 1 ELISA Kit
ELA-E12877h	Lifescience Market	96 Tests	EUR 824

Human B- Cell Translocation Gene 2 ELISA Kit
ELA-E14159h	Lifescience Market	96 Tests	EUR 824

Human ETS translocation variant 5, ETV5 ELISA KIT
ELI-09265h	Lifescience Market	96 Tests	EUR 824

Human ETS translocation variant 1, ETV1 ELISA KIT
ELI-09963h	Lifescience Market	96 Tests	EUR 824

Human ETS translocation variant 2, ETV2 ELISA KIT
ELI-26930h	Lifescience Market	96 Tests	EUR 824

Human ETS Translocation Variant 4 (ETV4) ELISA Kit
abx596481-96tests	Abbexa	96 tests	EUR 723
Shipped within 1-2 weeks.

Human ETS Translocation Variant 4 (ETV4) ELISA Kit
20-abx387205	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human ETS Translocation Variant 5 (ETV5) ELISA Kit
20-abx387206	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human ETS translocation variant 4, ETV4 ELISA KIT
ELI-47261h	Lifescience Market	96 Tests	EUR 824

Human ETS translocation variant 3, ETV3 ELISA KIT
ELI-47548h	Lifescience Market	96 Tests	EUR 824

Guinea pig Breakpoint cluster region protein(BCR) ELISA kit
E05B0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Breakpoint cluster region protein(BCR) ELISA kit
E05B0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Breakpoint cluster region protein(BCR) ELISA kit
E05B0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Breakpoint cluster region protein(BCR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bcr ELISA Kit| Mouse Breakpoint cluster region protein ELISA Ki
EF014334	Lifescience Market	96 Tests	EUR 689

JTB Polyclonal Antibody
27433-100ul	SAB	100ul	EUR 252

JTB Polyclonal Antibody
27433-50ul	SAB	50ul	EUR 187

Anti-JTB Antibody
A07448	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for JTB Antibody (JTB) detection. Tested with WB in Human.

JTB Rabbit pAb
A10427-100ul	Abclonal	100 ul	EUR 308

JTB Rabbit pAb
A10427-200ul	Abclonal	200 ul	EUR 459

JTB Rabbit pAb
A10427-20ul	Abclonal	20 ul	EUR 183

JTB Rabbit pAb
A10427-50ul	Abclonal	50 ul	EUR 223

JTB Blocking Peptide
DF8670-BP	Affbiotech	1mg	EUR 195

JTB cloning plasmid
CSB-CL011970HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 441 Sequence: atgcttgcgggtgccgggaggcctggcctcccccagggccgccacctctgctggttgctctgtgctttcaccttaaagctctgccaagcagaggctcccgtgcaggaagagaagctgtcagcaagcacctcaaatttgccatgctggctggtggaagagtttgtggtagcagaaga Show more
Description: A cloning plasmid for the JTB gene.

JTB cloning plasmid
CSB-CL011970HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 354 Sequence: atggcctggggctggcatttatctttcctttcagcaagcacctcaaatttgccatgctggctggtggaagagtttgtggtagcagaagagtgctctccatgctctaatttccgggctaaaactacccctgagtgtggtcccacaggatatgtagagaaaatcacatgcagctcatc Show more
Description: A cloning plasmid for the JTB gene.

JTB Polyclonal Antibody
ABP53569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the N-terminal region of human JTB at AA rangle: 20-100 Applications tips:
Description: A polyclonal antibody for detection of JTB from Human. This JTB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human JTB at AA rangle: 20-100

JTB Polyclonal Antibody
ABP53569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the N-terminal region of human JTB at AA rangle: 20-100 Applications tips:
Description: A polyclonal antibody for detection of JTB from Human. This JTB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human JTB at AA rangle: 20-100

JTB Polyclonal Antibody
ABP53569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the N-terminal region of human JTB at AA rangle: 20-100 Applications tips:
Description: A polyclonal antibody for detection of JTB from Human. This JTB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human JTB at AA rangle: 20-100

JTB Polyclonal Antibody
ES4568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JTB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

JTB Polyclonal Antibody
ES4568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JTB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

pCMV-SPORT6-JTB
PVT12389	Lifescience Market	2 ug	EUR 391

Anti-JTB antibody
STJ112459	St John's Laboratory	100 µl	EUR 277

Anti-JTB antibody
STJ93809	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to JTB.

Anti-JTB (4E7)
YF-MA17516	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to JTB

Human ETS translocation variant 3- like protein, ETV3L ELISA KIT
ELI-20562h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human TRAM1 (Translocation Associated Membrane Protein 1)
ELK4370	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Translocation Associated Membrane Protein 1 (TRAM1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated ant Show more
Description: A sandwich ELISA kit for detection of Translocation Associated Membrane Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human B-Cell Translocation Gene 1 Protein (BTG1) ELISA Kit
20-abx386093	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Neuroblastoma breakpoint family member 9, NBPF9 ELISA KIT
ELI-20666h	Lifescience Market	96 Tests	EUR 824

Human Neuroblastoma breakpoint family member 6, NBPF6 ELISA KIT
ELI-22336h	Lifescience Market	96 Tests	EUR 824

Human Neuroblastoma breakpoint family member 1, NBPF1 ELISA KIT
ELI-22969h	Lifescience Market	96 Tests	EUR 824

Human Neuroblastoma breakpoint family member 4, NBPF4 ELISA KIT
ELI-45562h	Lifescience Market	96 Tests	EUR 824

Human Neuroblastoma breakpoint family member 3, NBPF3 ELISA KIT
ELI-38395h	Lifescience Market	96 Tests	EUR 824

Human Neuroblastoma breakpoint family member 5, NBPF5 ELISA KIT
ELI-38396h	Lifescience Market	96 Tests	EUR 824

Human Neuroblastoma breakpoint family member 8, NBPF8 ELISA KIT
ELI-36703h	Lifescience Market	96 Tests	EUR 824

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Recombinant human Translocation protein SEC63 homolog
P2236	FN Test	100ug	Ask for price
Uniprot ID: Q9UGP8 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Translocation protein SEC63 homolog

JTB ORF Vector (Human) (pORF)
ORF005502	ABM	1.0 ug DNA	EUR 95

JTB ORF Vector (Human) (pORF)
ORF005503	ABM	1.0 ug DNA	EUR 95

JTB Protein Vector (Human) (pPB-C-His)
PV022005	ABM	500 ng	EUR 329

JTB Protein Vector (Human) (pPB-N-His)
PV022006	ABM	500 ng	EUR 329

JTB Protein Vector (Human) (pPM-C-HA)
PV022007	ABM	500 ng	EUR 329

JTB Protein Vector (Human) (pPM-C-His)
PV022008	ABM	500 ng	EUR 329

JTB Protein Vector (Human) (pPB-C-His)
PV022009	ABM	500 ng	EUR 329

JTB Protein Vector (Human) (pPB-N-His)
PV022010	ABM	500 ng	EUR 329

JTB Protein Vector (Human) (pPM-C-HA)
PV022011	ABM	500 ng	EUR 329

JTB Protein Vector (Human) (pPM-C-His)
PV022012	ABM	500 ng	EUR 329

Recombinant Human JTB Protein, His, E.coli-10ug
QP12474-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human JTB Protein, His, E.coli-1mg
QP12474-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human JTB Protein, His, E.coli-2ug
QP12474-2ug	EnQuireBio	2ug	EUR 155

ETS Translocation Variant 6 (ETV6) ELISA Kit
abx595749-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

ETS Translocation Variant 1 (ETV1) ELISA Kit
abx595765-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

ETS Translocation Variant 6 (ETV6) ELISA Kit
abx596482-96tests	Abbexa	96 tests	EUR 723
Shipped within 1-2 weeks.

Rat Active breakpoint cluster region related protein(ABR) ELISA kit
E02A1163-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Active breakpoint cluster region related protein(ABR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Active breakpoint cluster region related protein(ABR) ELISA kit
E02A1163-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Active breakpoint cluster region related protein(ABR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Active breakpoint cluster region related protein(ABR) ELISA kit
E02A1163-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Active breakpoint cluster region related protein(ABR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human JTB(Jumping Translocation Breakpoint Protein) ELISA Kit